View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_50 (Length: 282)
Name: NF11537_low_50
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 14 - 265
Target Start/End: Complemental strand, 54350394 - 54350143
Alignment:
| Q |
14 |
agagttattattattgtgaacaaattccattacatctctttgactgctagtaaattaacgagcaaataaaaatgcaaaattgaccagacaaatttcaatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54350394 |
agagttattattattgtgaacaaattccattacatctctttgactgctagtaaattaacgaacaaataaaaatgcaaaattgaccagacaaatttcaatt |
54350295 |
T |
|
| Q |
114 |
gttattcagtagtatatttgttttttaaaaatctcgtatacctacctcatttattacctaaatattatacttgttttggactaggcaaaaaccgagtcca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
54350294 |
gttattcagtagtatatttgttttttaaaaatctcgtatacctacctcatttattacctaaatattatacctgttttggactaggcgaaaaccgagtcca |
54350195 |
T |
|
| Q |
214 |
ccataaattagggtccaattactcaaattcccaacaagcaaagccaaccctt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54350194 |
ccataaattagggtccaattactcaaattcccaacaagcaaagccaaccctt |
54350143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University