View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_56 (Length: 261)
Name: NF11537_low_56
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_56 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 43126196 - 43126439
Alignment:
| Q |
18 |
agaattcggtgctggattcaacttgaggagatgaaaaagacatgcttagaagaagaagaaaagaaaatagggaaattattaattaatggattataaactt |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43126196 |
agaattcggtgttggattcaacttgaggagatgaaaaagacatgcttagaagaagaagaaaagaaaatagggaaattattaattaatggatgataaactt |
43126295 |
T |
 |
| Q |
118 |
ggttgccttggataatttttaagatgttgcaattaaatatcaatgtttgtattcagttaagttgcaaatgttgacgatgctacaactaaatgtattacca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43126296 |
ggttgccttggataatttttaagatgttgcaattaaatatcaatgtttgtattcagttaagttgcaaatgttgacgatgctacaactaaatgtattacca |
43126395 |
T |
 |
| Q |
218 |
gaatgggttaattttgggtgcaaattgttggaattatattttac |
261 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43126396 |
gaaggggttaattttgggtgcaaattgttggaattatattttac |
43126439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University