View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_62 (Length: 245)
Name: NF11537_low_62
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 234
Target Start/End: Complemental strand, 45457621 - 45457405
Alignment:
| Q |
21 |
actacattatattacacgtatgaatatgatgatatcaatatcaacacatatgttatgatattgactcacagtcaatcacaaacaacatgtgcattcattc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45457621 |
actacattatattacacgtatgaatatgatgatatcaatatcaacacatatgttatgatattgactcacagtcaatcacaaacaacatgtgcattcattc |
45457522 |
T |
 |
| Q |
121 |
agacatacatagtgatcttcacgttaatgtgaatcaattatattgtatctccttgatctgtcactgtggacggacagcttattattatta---ttataat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45457521 |
agacatacatagtgatcttcacgttaatgtgaatcaattatattgtatcaccttgatctgtcactgtggacggacagcttattattattattattataat |
45457422 |
T |
 |
| Q |
218 |
tcatcccctcatttcat |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45457421 |
tcatcccctcatttcat |
45457405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University