View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_65 (Length: 240)
Name: NF11537_low_65
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 7340048 - 7340252
Alignment:
| Q |
14 |
gagcacagaagtcatctctttaaactccaaatactttctaagattctcaagtgtttcttccattctcttcgcgatggttttaaaattggatgtatgatgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340048 |
gagcacagaagtcatctctttaaactccaaatactttctaagattctcaagtgtttcttccattctcttcgcgatggttttaaaattggatgtatgatgt |
7340147 |
T |
|
| Q |
114 |
atcttaattcacggtgtatcttaacttaaccagcataaatagaattttcaccaaatttcagcaaataatgcctgtattttaataccagtgcaatctcaag |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340148 |
atcttaattcacggtgtat-----cttaaccagcataaacagaattttcaccaaatttcagcaaataatgcctgtattttaataccagtgcaatctcaag |
7340242 |
T |
|
| Q |
214 |
aggtgtgatt |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
7340243 |
aggtgtgatt |
7340252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University