View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_73 (Length: 231)
Name: NF11537_low_73
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 24 - 215
Target Start/End: Complemental strand, 6022462 - 6022271
Alignment:
| Q |
24 |
ggatttagaattctcaagaaactattttctagcaaaggaattaacatcttcagtgaagaaatcgaaacacaagattaccgatattgatgttgttgatgaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6022462 |
ggatttagaattctcaagaaactattttctagcaaaggaattaacatcttcagtgaagaaatcgaaacacaagattaccgatattgatgttgttgatgaa |
6022363 |
T |
 |
| Q |
124 |
caggtatgtatcatttgatgaatgaaaatgaactttattttctcttgaatttttctgcttatactttagtttttgattctgtatgtgattag |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6022362 |
caggtaggtatcatttgatgaatgaaaatgaactttattttctcttgaatttttctgcttatattttagtttttgattctgtatgtgattag |
6022271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University