View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_76 (Length: 228)
Name: NF11537_low_76
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_76 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 7697860 - 7698069
Alignment:
| Q |
7 |
atatccttgtaagagtgatgtctcagaatcattggtaaagagacaaaagtgttcaaatgaggaggggttgcaattgcttcaatcctcagtaaatcttgtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7697860 |
atatccttgtaagagtgatgtctcagaatcattggtaaagagacaaaagtgttcaaatgaggaggggttgcaattgcttcaagcctcagtaaatcttgtg |
7697959 |
T |
|
| Q |
107 |
ttttactgtttgcttcgtgtttcta-ttttttgcttgatagnnnnnnnnngtttcaatccaatttcaagaatcttttagttgaattttccatttattgtt |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7697960 |
ttttactgtttgcttcgtgtttctatttttttgcttgata----------gttt---ttgtgtttcaagaatcttttagttgaattttccatttattgtt |
7698046 |
T |
|
| Q |
206 |
tcataagagcattggagtgcgac |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7698047 |
tcataagagcattggagtgcgac |
7698069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 50030276 - 50030204
Alignment:
| Q |
156 |
gtttcaatccaatttcaagaatcttttagttgaattttccat---ttattgtttcataagagcattggagtgc |
225 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||||||| ||| |||| ||||||||||||| ||||||||| |
|
|
| T |
50030276 |
gtttcaatccgatttcaagaatctattacttgaatttttcatctattatcgtttcataagagcgttggagtgc |
50030204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University