View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11537_low_79 (Length: 225)
Name: NF11537_low_79
Description: NF11537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11537_low_79 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 560128 - 560321
Alignment:
| Q |
1 |
taaaggaaaagtatcgggtgacattcaaggatcatatcctttaatttcaggttgcaaacttggagtgtttgagggtaaaaaccatacttacattggtgat |
100 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
560128 |
taaaggacaaggatcgggtgacatacaaggatcatatcctttaatttcaggttgcaaacttggagtgtttgagggtaaaaaccatacttacattggtgat |
560227 |
T |
 |
| Q |
101 |
tgcatggtgaataaaattctaggaaaatgtaggggcttgaatgtaacaaagattatttgtgtgactcaagaccaatttctttgtgcattatcta |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
560228 |
tgcatggtgaataaaattctaggaaaatgtaggtgtttgaatgtaaaaaagattatttgtgtgactcaagaccaatttctttgtgcattatcta |
560321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University