View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_109 (Length: 239)
Name: NF11538_high_109
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_109 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 45 - 165
Target Start/End: Complemental strand, 39928411 - 39928291
Alignment:
| Q |
45 |
tagaagagaataggcacgtgtttaatccatttcaaaaacatatttaatcatggtgcttttgaagaacgcttaaaatcccttatattatctaacaaagcgc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39928411 |
tagaagagaataggcacgtgtttaatccatttcaaaaacatatttaatcatggtgcttttgaagaacgcttaaaatcccttatattatctaacaaagcgc |
39928312 |
T |
|
| Q |
145 |
tagtatgatgaatttttacat |
165 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
39928311 |
tagtatgatgaattttaacat |
39928291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 39928254 - 39928211
Alignment:
| Q |
180 |
ttcatcctttatatctgtttaacagagaactttttagaactatc |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39928254 |
ttcatcctttatatctgtttaacagaggactttttagaactatc |
39928211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University