View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_113 (Length: 238)
Name: NF11538_high_113
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_113 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 51910932 - 51911167
Alignment:
| Q |
1 |
attggtcctgtaatatgcttcatcccacttatcatcaatacctctaagaaatgcaaattgccaagtgctggagaaagagtgcccttcatataagtgccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51910932 |
attggtcctgtaatatgcttcatcccacttatcatcaatacctctaagaaatgcaaattgccaagtgctggagaaagagtgcccttcatataagtgccac |
51911031 |
T |
 |
| Q |
101 |
tatctctaacattagaattttgtatctgcaacacattaactctacctgtggatggattacattgaactccttcccaccctccgtcgcagcaatctcggcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51911032 |
tatctctaacattagaattttgtatctgcaacacattaactctacctgtggatggatgacattgaactccttcccaccctccgtcgcagcaatctcggcc |
51911131 |
T |
 |
| Q |
201 |
tacccatgtagataaagtatctgttgtgtcactcga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51911132 |
tacccatgtagataaagtatctgttgtgtcgctcga |
51911167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University