View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_117 (Length: 231)
Name: NF11538_high_117
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_117 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 32709492 - 32709398
Alignment:
| Q |
1 |
cctacctccaacaacattgcctatcggtgagttctgttttctcgaacccaacttcaaaaattctatcttttcacaatcctctttaatgggttgcg |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32709492 |
cctacctccaacaacattgcctatcggtgagttctgttttctcgaacccagcttcaaaaattctatcttttcacaatcctctttaatgggttgcg |
32709398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 203
Target Start/End: Complemental strand, 32709323 - 32709290
Alignment:
| Q |
170 |
actcattattacttgagatgactttctgggtcta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32709323 |
actcattattacttgagatgactttctgggtcta |
32709290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University