View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_51 (Length: 398)
Name: NF11538_high_51
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 137 - 383
Target Start/End: Complemental strand, 39167757 - 39167511
Alignment:
| Q |
137 |
ctggaggcattttttgtgtttgcagattattgccgctgccagagatgtccaggaaaacctggagatttatgcacattcatataatattcttcctctagat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167757 |
ctggaggcattttttgtgtttgcagattattgccgctgccagagatgtccaggaaaacctggagatttatgcacattcatataatattcttcctctagat |
39167658 |
T |
 |
| Q |
237 |
gctgctggtgcttctctgcccattatgcagtttgaagaggtgtttttgagtgactaatgttaaatccttgcgtttctttaaccggacatagtatgagttt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39167657 |
gctgctggtgcttctctgcccattatgcagtttgaagaggtgtttttgagtgactaatgttaaatccttgcgtttctttaactggacatagtatgagttt |
39167558 |
T |
 |
| Q |
337 |
gaactgctttcttttgctattagattaaggctgctgtttctgtgctc |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39167557 |
gaactgctttcttttgctattagattaaggctgctgtttctgcgctc |
39167511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 39167874 - 39167822
Alignment:
| Q |
20 |
aacaagactgagaaggtcgaagaagtagctcctgaggttagtctccattcata |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39167874 |
aacaagactgagaaggtcgaagaagtagctcctgaggttagtctccagtcata |
39167822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 43965377 - 43965335
Alignment:
| Q |
20 |
aacaagactgagaaggtcgaagaagtagctcctgaggttagtc |
62 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
43965377 |
aacaagactgagaaagtcgaagaagttgctcctgaggttagtc |
43965335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University