View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_53 (Length: 389)
Name: NF11538_high_53
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 37950706 - 37950498
Alignment:
| Q |
22 |
ggggagccctgatatggaacccaaacataaggatccaccggtagacctctgcaaatgaccttctacaacnnnnnnnnnnnnnnnnnnggtcaaaccttct |
121 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
37950706 |
ggggagccctgatatggatccaaaaaataaggatccaccggtagacctatgcaaatgaccttctacaacttttttttattttttt--ggtcaaaccttct |
37950609 |
T |
|
| Q |
122 |
acaaccttttactctcacctatgtagaaattcatcaaaaaataaaattatgcagaaaatcttcgacacatatttcctctatcttcataattaaagaatca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37950608 |
acaaccttttactctcacctatgtagaaattcatcaaaaaataaaattatgcagaaaatcttcgacacatatttcctctatcttcataattaaaggatca |
37950509 |
T |
|
| Q |
222 |
agccttattat |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
37950508 |
agccttattat |
37950498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 278 - 389
Target Start/End: Complemental strand, 37950457 - 37950346
Alignment:
| Q |
278 |
ttaagttgaggttgttgaggttcttttgcatatctataaatgtaaaatgtttatgaccgttgttgttgtttttgcacagtggcagtgtcactacgaatcg |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37950457 |
ttaagttgaggttgttgaggttcttttgcatatctataaatgtaaaatgtttatgaccgttgttgttgtttttgcacagtggcagtgtcactacgaatcg |
37950358 |
T |
|
| Q |
378 |
aaaggatcattt |
389 |
Q |
| |
|
||||||||||| |
|
|
| T |
37950357 |
gaaggatcattt |
37950346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 141 - 232
Target Start/End: Original strand, 10766393 - 10766484
Alignment:
| Q |
141 |
tatgtagaaattcatcaaaaaataaaattatgcagaaaatcttcgacacatatttcctctatcttcataattaaagaatcaagccttattat |
232 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||||||||||||||||| | |||||||||| ||||| |||||||||| ||| | ||||||||| |
|
|
| T |
10766393 |
tatgcagaagttcatcaaaacataaaattatgcagaaaatcttcgatagatatttcctccatcttaataattaaaggatcgaaccttattat |
10766484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University