View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_62 (Length: 360)
Name: NF11538_high_62
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_62 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 6551753 - 6552081
Alignment:
| Q |
1 |
tagtgtgtgtggtgctattccatcgatatatctatcatatagataaattactcctttggcataaagatcaatcacttatgtctgattttgaggctattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6551753 |
tagtgtgtgtggtgctattccatcgatatatc----atatagataaattactcctttggcataagaatcaatcacttatgtctgattttgaggctattat |
6551848 |
T |
|
| Q |
101 |
tcgtttagttttattatatgaagttgatgtttctcggtttgttgtggtggttgctagtggcatatccagaattttatagggatgaagaaa-gnnnnnnnt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6551849 |
tcgtttagttttattatatgaagttgatgtttcacggtttgttgtggtggttgctagtggcatatccagaattttatagggatgaagaaataaaaaaaat |
6551948 |
T |
|
| Q |
200 |
tgaaaggttttttagaatttagtgtctgcaaatactccaaagctttggtcaattcatgaatgagatagttgaaaggttttttagaatatagtgtgtgtaa |
299 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6551949 |
tgaaaggttttttagaatttagtgtttgcaaatactccaaagctttggtcaattcatgaatgagatagttgaaaggttttttagaatatagtgtgtgtaa |
6552048 |
T |
|
| Q |
300 |
ctttctcctcatgcaaatgtttatttatggaaa |
332 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
6552049 |
ctttctcctcatgcaaatgtttatttatagaaa |
6552081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University