View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_65 (Length: 359)
Name: NF11538_high_65
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 166 - 352
Target Start/End: Complemental strand, 44533918 - 44533732
Alignment:
| Q |
166 |
cttcaaatgtagttggaggtctccattgttgttctggctgcaccatcaatggctccatcgtctcatttgacttcatgctatgaaacgaattagaaccaaa |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44533918 |
cttcaaatgtagttggaggtctccattgttgttctggctgcaccatcaatggctccatcgtctcatttgacttcatgctatgaaacgaattagaaccaaa |
44533819 |
T |
 |
| Q |
266 |
aaggttctgtgttttgttcttttctttgtaaatagcttcaagttcattaaaataaggacatgtcttactatcatcacgcctttgctt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44533818 |
aaggttctgtgttttgttcttttctttgtaaatagcttcaagttcattaaaataaggacatgtcttactatcatcacgcctttgctt |
44533732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University