View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_93 (Length: 265)
Name: NF11538_high_93
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_93 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 26210950 - 26211214
Alignment:
| Q |
1 |
tacgcagagagaagcgcgtgacggtgacgcttcggaaaacggagagtgaagctgcgtttttcttctacagaatcctgcatggtgtctacatggtgtgtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26210950 |
tacgcagagagaagcgcgtgacggtgacgcttcggaaaacggagcgtgaagctgcgtttttcttctacagaatcctgcatggtgtctacatggtgtgtcc |
26211049 |
T |
|
| Q |
101 |
atgagagacggtggttgttgaacgtgtcatggacggtgtggtttggtgcaacagcgaaggatatgcggttggaggaaggagagcgtgagagtgtgagacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211050 |
atgagagacggtggttgttgaacgtgtcatggacggtgtggtttggtgcaacagcgaaggatatgcggttggaggaaggagagcgtgagagtgtgagacg |
26211149 |
T |
|
| Q |
201 |
gcgacatgcggtggcagaggtgtggttgacggcgttgaggtagagatgaacgtggcggtagaggt |
265 |
Q |
| |
|
||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26211150 |
gcggcatgcggtggcagaggagtggttgacggcgttgaggtagagatggacgtggcggtagaggt |
26211214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University