View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_96 (Length: 261)
Name: NF11538_high_96
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 19 - 128
Target Start/End: Complemental strand, 1705773 - 1705664
Alignment:
| Q |
19 |
atgaccttctttcttacaaatgttcctcttagatacgacaccgtttagtttgttttccgattctgcggtcttgtacagggtcatcaattttaataaaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1705773 |
atgaccttctttcttacaaatgttcctcttagatacgacaccgtttagtttgttttccgattctgcggtcttgtacagggtcgtcaattttaataaaaaa |
1705674 |
T |
 |
| Q |
119 |
ttgttcattc |
128 |
Q |
| |
|
|||| ||||| |
|
|
| T |
1705673 |
ttgtacattc |
1705664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 192 - 258
Target Start/End: Complemental strand, 1705598 - 1705536
Alignment:
| Q |
192 |
tagagtagaagaatcttaattaatcttaagtactggcatgaattgcttgaaactcatttggcgtcac |
258 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
1705598 |
tagagtagaagaatcttaatg----ttaagtaccggcatgaattgcttgaaattcatttggcgtcac |
1705536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University