View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_high_99 (Length: 253)
Name: NF11538_high_99
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_high_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 12 - 234
Target Start/End: Original strand, 10023696 - 10023917
Alignment:
| Q |
12 |
agagaccccaaatgccatttaaagaattgaaatgaagggaataatttagaatggtggctaaccaagacaacatttttaaagcaaaatcacattgnnnnnn |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10023696 |
agagaccccaaatgtcatttaaagaattgaaatgaagggaataatttagaatggtggctaaccaagacaacatttttaaagcaaaatcacattgaaaaaa |
10023795 |
T |
 |
| Q |
112 |
nngaagataaaaagtggtttcttcactattttggcagcagctgcagactgagggcaaactaacacctctttcctttaatttctcatcagtggggacccta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10023796 |
aagaagataaaaagtggtttcttcactattttggcagcagctgcagactgagggcaaactaacacctc-ttcctttaatttctcatcagtggggacccta |
10023894 |
T |
 |
| Q |
212 |
tcatgcataatcctccaacctag |
234 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
10023895 |
tattgcataatcctccaacctag |
10023917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University