View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_113 (Length: 238)
Name: NF11538_low_113
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_113 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 37991103 - 37990887
Alignment:
| Q |
12 |
cacagaatcagaaagaaagnnnnnnngtggtactgcatgtcttgtatattttgctttgcttttgacaaaataggtgtacgtataagcacacgcacac--- |
108 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37991103 |
cacagaatcagaaagaaagaaaaaaagtggcactgcatgtcttgtttattttgctttgcttttgacaaaataggtgtacgtataagcacacgcacacgca |
37991004 |
T |
|
| Q |
109 |
---atgctgcagtattctgttccgggaatagtttcaagactataggtaaagagaatgaagccaataagctataggacgaataatctagacttcattttga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37991003 |
cacatgctgcagtattctgttccgggaatagtttcaagactataggtaaagagaatgaagccaataagctataggacgaataatctagacttcattttga |
37990904 |
T |
|
| Q |
206 |
tttttgactgaagacac |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37990903 |
tttttgactgaagacac |
37990887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University