View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_115 (Length: 235)
Name: NF11538_low_115
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_115 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 37091584 - 37091803
Alignment:
| Q |
1 |
tagaatggccttcaaattctgaaagaagaaatacataaatataaatatacttatagtttatgtgagatttctcaaatattgaacactacttctcaaatgg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091584 |
tagaatggccttcaaatcctgaaagaagaaatacataaatataaatatacttatagtttatgtgagatttctcaaatattgaacactacttctcaaatgg |
37091683 |
T |
|
| Q |
101 |
cacaaaatgatagcagaagtcattgaattgagatcagacgacttagctcacacattaaataaattaattttaaacgatcttaactattgatttaaataag |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37091684 |
cacaaaatgatagcagaagacattgaattgagatcagacgacttagctcacacattcaataaattaattttaaacgatcttaactaaagatttaaataag |
37091783 |
T |
|
| Q |
201 |
acggtcgagatcattaactg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37091784 |
acggtcgagatcattaactg |
37091803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 54634187 - 54634144
Alignment:
| Q |
160 |
taaattaattttaaacgatcttaactattgatttaaataagacg |
203 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
54634187 |
taaatcaattttaaacgattttaactattgatttaaatcagacg |
54634144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University