View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_116 (Length: 234)
Name: NF11538_low_116
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_116 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 4247486 - 4247302
Alignment:
| Q |
1 |
tgctcgaccaaaaactggcattaaggatttgcatttcatcaacaaatataatatgcatagaaaatgaacatgataaagtgattggacaaattctccattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4247486 |
tgctcgaccaaaaactggcattaaggatttgcatttcatcaacaaatat-----gcatagaaaatgaacatgataaagtgattggacagattctccattg |
4247392 |
T |
 |
| Q |
101 |
gagacaaccccaaacaaaatgttatgtacaatatgcagctaacaagactatcggtgatttgatatcaagctcaagctaaggaccttcaaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247391 |
gagacaaccccaaacaaaatgttatgtacaatatgcagctaacaagactattggtgatttgatatcaagctcaagctaaggaccttcaaa |
4247302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University