View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_118 (Length: 231)
Name: NF11538_low_118
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_118 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 36026761 - 36026556
Alignment:
| Q |
1 |
aaatacatctttcaggttttataatctcaaaaatgtcttatcaaatggaaggtaaggtcacgtccaccaattccaacccactcgtgggaaattgagttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026761 |
aaatacatctttcaggttttataatctgaaaaatgtcttatcaaatggaaggtaaggtcacgtccaccaattccaacccactcgtgggaaattgagttga |
36026662 |
T |
 |
| Q |
101 |
actggaggagggctaggagacttagtactagcatgcacactttctctacttcgattgtgaaatttgtgtatctggaggcgagagttgacacgttcagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||| ||| |
|
|
| T |
36026661 |
actggaggagggctaggagacttattactagcatgcacactttctctacttcgattgtgaaatttgtgcatctggagacgagagtcgacacgttcaaaga |
36026562 |
T |
 |
| Q |
201 |
gagaag |
206 |
Q |
| |
|
|||||| |
|
|
| T |
36026561 |
gagaag |
36026556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University