View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11538_low_119 (Length: 231)

Name: NF11538_low_119
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11538_low_119
NF11538_low_119
[»] chr4 (2 HSPs)
chr4 (1-95)||(32709398-32709492)
chr4 (170-203)||(32709290-32709323)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 32709492 - 32709398
Alignment:
1 cctacctccaacaacattgcctatcggtgagttctgttttctcgaacccaacttcaaaaattctatcttttcacaatcctctttaatgggttgcg 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
32709492 cctacctccaacaacattgcctatcggtgagttctgttttctcgaacccagcttcaaaaattctatcttttcacaatcctctttaatgggttgcg 32709398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 203
Target Start/End: Complemental strand, 32709323 - 32709290
Alignment:
170 actcattattacttgagatgactttctgggtcta 203  Q
    ||||||||||||||||||||||||||||||||||    
32709323 actcattattacttgagatgactttctgggtcta 32709290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University