View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_35 (Length: 469)
Name: NF11538_low_35
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 125 - 460
Target Start/End: Original strand, 224335 - 224671
Alignment:
| Q |
125 |
tgcttcaagatccaaatgagcaaaagcattccattaaagcctaacaatgccatagttttggtgactgtaaattgtaaaatatcaaacacgatcaagttgt |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
224335 |
tgcttcaagaaccaaatgagcaaaagcattccattaaagcctaacaatgccatagtt--ggtgaatgtaaattgtaaaatatcaaacaagatcaagttgt |
224432 |
T |
|
| Q |
225 |
aacacaactggcgatgatttcttaatcaactcaaccttgcatttatcaccgtttgacaaattgttgtccgttgcaaatttaatgaatcctttccccaatc |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
224433 |
aacacaactggcgatgatttcttaatcaactcaaccttgcatttatcaccgtttgacaaattgttgtacgttgcaaatttaatgaatcctttccccaatc |
224532 |
T |
|
| Q |
325 |
gcagtcctgaacgacctaaacgtgtacaacaaacatcccattgct---ctccattgcaattttcgagcttcacaacaacatttcgtttcagatgctttga |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
224533 |
gcagtcctgaacgacctaaacgtgtacaacaaacatcccattgctctcctccattgcaattttggagcttcacaacaacatttcgtttcagatgctttga |
224632 |
T |
|
| Q |
422 |
tgcaaaatcagcattaatatactgcacaagggagcgagg |
460 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224633 |
tgcaaaatcagcattaatatactgcacaagggagcgagg |
224671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 398 - 449
Target Start/End: Original strand, 216723 - 216774
Alignment:
| Q |
398 |
aacatttcgtttcagatgctttgatgcaaaatcagcattaatatactgcaca |
449 |
Q |
| |
|
||||||| | |||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
216723 |
aacatttggattcagatgctttgaagcaaaatcagcattaacatactgcaca |
216774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 62 - 96
Target Start/End: Complemental strand, 224294 - 224260
Alignment:
| Q |
62 |
gaataattatcacatgagtttgactgagccattct |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
224294 |
gaataattatcacatgagtttgactgagccattct |
224260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University