View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_57 (Length: 372)
Name: NF11538_low_57
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 362
Target Start/End: Complemental strand, 37980417 - 37980075
Alignment:
| Q |
19 |
agcttcttctccaactcatgtcaaatcttctccttctttagctgaagaatacaattcttggattgtgagcacag-----tcactctgttttcactgttat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
37980417 |
agcttcttctccaactcatgtcaaatcttctccttctttagctgaagaatacaattcttggattgtgagcaccgtcacatcactctgttttcactgttat |
37980318 |
T |
 |
| Q |
114 |
atatatttcaatataaaaactccaaaattttgaacaaatactggatctgaatatttttatcttttatgatggtaaaatactcgtgcattcacacatgtct |
213 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
37980317 |
atatatttca--ataaaaactccaaaaatttgaacaaatactggatctgaatatttt--tcttttatgatagtaaaatactcgtgcattcacacatgtat |
37980222 |
T |
 |
| Q |
214 |
tgnnnnnnnatcgaacagcttcgccatccatctgcattagatatgtttgaacaaattatggatgctgcaaaaggaaaacagattgttatgtttttggact |
313 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37980221 |
t--atttttatcgaacagcttcgccatccatctgcattagatatgtttgaacaaattatggatgctgcaaaaggaaaacagattgttatgtttttggact |
37980124 |
T |
 |
| Q |
314 |
atgatggtactttgtcacctattgtcgatgaccctgaccgtgctttcat |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37980123 |
atgatggtactttgtcacctattgtcgatgaccctgaccgtgctttcat |
37980075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 305 - 362
Target Start/End: Original strand, 13311328 - 13311385
Alignment:
| Q |
305 |
ttttggactatgatggtactttgtcacctattgtcgatgaccctgaccgtgctttcat |
362 |
Q |
| |
|
|||||||||||||||| || || ||||| ||||| ||| |||||||| |||||||||| |
|
|
| T |
13311328 |
ttttggactatgatggaacattttcacccattgtggataaccctgactgtgctttcat |
13311385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University