View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_60 (Length: 366)
Name: NF11538_low_60
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_60 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 138 - 366
Target Start/End: Complemental strand, 20157806 - 20157578
Alignment:
| Q |
138 |
aaaatgtttgattttttataagtgattttaaaaataaattcaaaatgttgtgtctcacacacactcattgattgtagttttgcagttttcagaagcattt |
237 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20157806 |
aaaatgtttgattttttatcagtgattttaaaaataaattcaaaatgttgtgtctcacacacactcattgattgtagttttgcagttttcagaagcattt |
20157707 |
T |
|
| Q |
238 |
gagtagaaagagcttggtttgttgtctaagtgtgaaagcaatggggtctaaaagacccttttcaaattcatcacaacccatttcatcatttgttgaggtc |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20157706 |
gagtagaaagagcttggtttgttgtctaagtgtgaaagcaatggggtctaaaaggcccttttcaaattcctcacaacccatttcatcatttgttgaggtc |
20157607 |
T |
|
| Q |
338 |
aagaatgatatgaatctcaaaggtttaga |
366 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
20157606 |
aagaatgatatgaacctcaaaggtttaga |
20157578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University