View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_69 (Length: 345)
Name: NF11538_low_69
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 10 - 329
Target Start/End: Complemental strand, 32981852 - 32981533
Alignment:
| Q |
10 |
gcagagacattgcatattatggtcttcaagtccacttcggattatgcgacagtttgtgagactagttaacaaaatgaaccctatatggaattgaatgtat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32981852 |
gcagagacattgcatattatggtcttcaagtccacttcggattatgtgacagtttgtgagactagttaacaaaatgaaccctatatggaattgaatgtat |
32981753 |
T |
 |
| Q |
110 |
atatgaatgttcatgcccgttctagatattttgttaactcatatttgattgttagtcctcttgggcatgaataccaacacagtgtaaataatgatgaata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32981752 |
atatgaatgttcatgcccgttctagatattttgttaactcatatttgattgttagtcctcttgggcatgaataccaacacagtgtaaataatgatgaata |
32981653 |
T |
 |
| Q |
210 |
cacgaatgaagacatatatgattacaattttgattgaatggcatagcaaatattaggttgcatcattgtcaacatcaagatgagcaagccctggtctctt |
309 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32981652 |
caagaatgaagacatatatgattacaattttgattgaatggcatagcaaatattaggttgcgtcattgtcaacatcaagatgagcaagccctggtctctt |
32981553 |
T |
 |
| Q |
310 |
cttgcccctacccgaaaaag |
329 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32981552 |
cttgcccctacccgaaaaag |
32981533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University