View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_73 (Length: 338)
Name: NF11538_low_73
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 10583602 - 10583440
Alignment:
| Q |
1 |
aatacatggtgactcatactctttgacctctgtctctctctattttggttcagcttacagtgattcaatctcaccgaaatgacgtacacctttatttata |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10583602 |
aatacatggcgactcatactctttgacctctgtctctctctattttggttcagcttacagtgattcaatctcaccgaaatgacgtacacctttatttata |
10583503 |
T |
 |
| Q |
101 |
gaggttttgaaatgttaagttcactatgcaagataaggcttgcctagcaaatcgaggtttctt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
10583502 |
gaggttttgaaatgttaagttcactatgcaaaataaggctttcctagcaaatcgaggtttctt |
10583440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 160 - 312
Target Start/End: Complemental strand, 10583417 - 10583265
Alignment:
| Q |
160 |
tcttatgatattttctggaaccacctttgtttgcaaggcaaccatcgaaccaccttaaacttttccttctagaactctctgcattggctcgctttcacct |
259 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| ||||| |||||| ||||||||||||||||||||||||||| |||||| |||||||| ||||||||| |
|
|
| T |
10583417 |
tcttatgatattttctggaaccacgttagtttgtaaggcgaccatcaaaccaccttaaacttttccttctagaaatctctgtattggctcactttcacct |
10583318 |
T |
 |
| Q |
260 |
cgctcaactcgcctagcgaatcgagattttcatcagatgtctatatgatgctc |
312 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
10583317 |
cgctcaactcgcctagcgaatcaggattttcatcagatgtctatgtgatgctc |
10583265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 205 - 301
Target Start/End: Original strand, 20618473 - 20618569
Alignment:
| Q |
205 |
cgaaccaccttaaacttttccttctagaactctctgcattggctcgctttcacctcgctcaactcgcctagcgaatcgagattttcatcagatgtct |
301 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| | ||||||| |||||||||| ||||| |||| ||||| |||| || |||||| |||||||| |
|
|
| T |
20618473 |
cgaaccaccttaaatttttccctctagaactctcagtattggcttgctttcaccttgctcagctcgtctagcaaatcaagcttttcacaagatgtct |
20618569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 6 - 122
Target Start/End: Complemental strand, 25034965 - 25034849
Alignment:
| Q |
6 |
atggtgactcatactctttgacctctgtctctctctattttggttcagctt-acagtgattcaatctcaccgaaatgacgtacacctttatttatagagg |
104 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||| ||||||||||||||| | || ||| || | | ||| || ||| |||| ||||||| |||||||||||| |
|
|
| T |
25034965 |
atggtgactcatgctctttgtcctatgtctttctctattttggttcggttttacaatggctaattct-actgaattgacctacacctctatttatagagg |
25034867 |
T |
 |
| Q |
105 |
ttttgaaatgttaagttc |
122 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
25034866 |
tcttgaaatgttaagttc |
25034849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 122
Target Start/End: Original strand, 24967870 - 24967907
Alignment:
| Q |
85 |
tacacctttatttatagaggttttgaaatgttaagttc |
122 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
24967870 |
tacacctttatttatagagattttgaaaagttaagttc |
24967907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University