View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_77 (Length: 328)
Name: NF11538_low_77
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 15 - 310
Target Start/End: Original strand, 24562385 - 24562680
Alignment:
| Q |
15 |
cagagaggaccacataagaaatgacaccgaccatacaaagcgcagccctacacgtcttaataactacccaaggttgctctttgctaggcaactctttaga |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24562385 |
cagaaaggaccacataagaaatgacaccgaccatacaaagcgcagccctacacgtcttaataactacccaaggttgctctttgctgggcaactctttaga |
24562484 |
T |
 |
| Q |
115 |
tactgattaacttgatacacataattcccatgcacattctcaatgggcttcacaaatctcctatgagtacactgcagtggaaaatgcctcgtgtggagga |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562485 |
tactgattaacttgatacacgtaattcccatgcacattctcaatgggcttcacaaatctcctatgagtacactgcagtggaaaatgcctcgtgtggagga |
24562584 |
T |
 |
| Q |
215 |
cagtgttgttttcttcctgatgagcagcaaacttgatagcatgaccttcgaccaacctaagggtaaagcaagagatggcccagtcacctccgatct |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24562585 |
cagtgttgttttcttcctgatgagcagcaaacttgatagcatgaccttcgaccaacctaagggtaaagcaacagatggcccagtcacctccgatct |
24562680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University