View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_82 (Length: 309)
Name: NF11538_low_82
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 5e-56; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 155 - 301
Target Start/End: Complemental strand, 5752355 - 5752209
Alignment:
| Q |
155 |
tcctttccaaatacgggcaagttcacccaatgccaaatcccatcccttttcagtgctctttgcactgatcagattcatcccttatgcgtaaccacagatc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||||||||||||||| |||||||| ||| ||| |
|
|
| T |
5752355 |
tcctttccaaatacgggcaagttcacccaattccaaatcccaacccttttcagcactctttgcacggatcagattcatcccttgtgcgtaactacaaatc |
5752256 |
T |
 |
| Q |
255 |
ttggctgcgtaaagagccttcctaacatcatcaatcaactgcttctt |
301 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5752255 |
ttggctgcataaagagccttcctaacatcatcaatcaactgcttctt |
5752209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 2 - 79
Target Start/End: Complemental strand, 5752533 - 5752456
Alignment:
| Q |
2 |
acatacctgggatgctgatacctgaattgacagcaagggaaacaactctcctccatgcggtttggcattcaattattt |
79 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5752533 |
acatacccgggaggctgatacctgaattgacagcaagggaaacaactctcctccatgcggtttggcgttcaattattt |
5752456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 95 - 147
Target Start/End: Complemental strand, 5752452 - 5752399
Alignment:
| Q |
95 |
ttgcgaactttggatccacaagaaggtttgtaagattaggg-ttctgtcgtacg |
147 |
Q |
| |
|
||||||||| |||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
5752452 |
ttgcgaactctggatccacaagaaggttagcgagattagggtttctgtcgtacg |
5752399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University