View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_85 (Length: 299)
Name: NF11538_low_85
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_85 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 299
Target Start/End: Complemental strand, 47254280 - 47253992
Alignment:
| Q |
11 |
cacagatactcctgccaatttcaataaatttcatgtgaggttaatcatctcttgctttttctaagaaataggacatctcaagattttcctgtttaactca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254280 |
cacagatactcctgccaatttcaataaatttcatgtgaggttaatcatctcttgctttttctaagaaataggacatctcaagattttcctgtttaactca |
47254181 |
T |
 |
| Q |
111 |
actacatgaaacttagtatgtggttagttgtgcgtttaatttccgtcaccaaacgcacgtttatggctcttttactgtaatttaaagaagctccaaaatc |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47254180 |
actacatgaaacttagtatgtgtttagttgtgcgtttaatttccgtcaccaaacgcacgtttatggctcttttactgcaatttaaagaagctccaaaatc |
47254081 |
T |
 |
| Q |
211 |
aagcttccgtggcaatgtggtttctcaccatggaaatgttaaactcaccgttaaagcaaacacatgcttaatcgagggaactgctttgt |
299 |
Q |
| |
|
||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254080 |
aagcttctgtggcaatgtggtttttcaccacggaaatgttaaactcaccgttaaagcaaacacatgcttaatcgagggaactgctttgt |
47253992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University