View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_91 (Length: 284)
Name: NF11538_low_91
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 36715976 - 36716249
Alignment:
| Q |
1 |
ttacgttgcggttgtagtcacgtgcattgcaatctttcatattgtggaaaattgcagacatatgcaacttcatt-acagttgcaattttcacagtgcaga |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
36715976 |
ttacgttgcggttgtagtcacatgcattgcaatctttcatattgtggaaaattgcagacagatgcaacttcaatcacggttgcaattttcacagtgcaga |
36716075 |
T |
 |
| Q |
100 |
gatcaccaaaaatgttgtggccgtaatagtggttctgatccgcaatttaatatcatgacttcaggcatatatatgatgatatgagcgcacaatagatacg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
36716076 |
gatcaccaaaaatgttgtggccgtaatagtggttctgatccacaatttaatatcatgacttcaggcatatttatgatgatatgtgcgcacaatagatacg |
36716175 |
T |
 |
| Q |
200 |
aaactaattgagctttcaaaactgaaacaggtacctcctccagggaaagggacgctttatcttaggcctttgct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716176 |
aaactaattgagctttcaaaactgaaacaggtacctcctccagggaaagggacgctttatcttaggcctttgct |
36716249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University