View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11538_low_95 (Length: 264)
Name: NF11538_low_95
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11538_low_95 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 4255707 - 4255446
Alignment:
| Q |
1 |
tctaggcttctcaaacccaacaatttcaccttcttcaacaaaaagtgaagcaagtcgatcaggatcacgccacttaaccataacacaatcttctacaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4255707 |
tctaggcttctcaaacccaacaatttcaccttcttcaacaaaaagtgaagcaagtcgatcaggatcgcgccacttaaccataacacaatcttctacaatc |
4255608 |
T |
 |
| Q |
101 |
gatgatcctcgttgttcagagcgttgaaaattgtacctttcacttctttctttgattccatgaattgttaatttgatctcttgaatctcacacgctactc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4255607 |
gacgatcctcgttgttcagagcgttgaaaattgtacctttcacttctttctttgattccatgaattgttaatttgatctcttgaatctcacacgctactc |
4255508 |
T |
 |
| Q |
201 |
gatgacgaggttttaaggttttccatttcatcaatccaacaacattttgaagtttacctatg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
4255507 |
gatgacgaggttttaaggttttccatttcatcaatccaacaacattatgaagtttgcctatg |
4255446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University