View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11538_low_98 (Length: 257)

Name: NF11538_low_98
Description: NF11538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11538_low_98
NF11538_low_98
[»] chr1 (1 HSPs)
chr1 (52-121)||(27469992-27470059)


Alignment Details
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 52 - 121
Target Start/End: Original strand, 27469992 - 27470059
Alignment:
52 gtattgattccaatgaaaatataagttccatttatgcaataattcatttataatttttcatgataataca 121  Q
    |||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||| ||||||||    
27469992 gtattgattccaatgaaaata--agttccatttatgcaataattcatttataatttttcattataataca 27470059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University