View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_high_37 (Length: 292)
Name: NF1153_high_37
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_high_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 21 - 265
Target Start/End: Original strand, 22719033 - 22719277
Alignment:
| Q |
21 |
ttattatatattgattatggcataaacatttcaacacttttggggtgttggagccaaggattttgaggaaggatacatggagaatcgacacccgcgtgct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22719033 |
ttattatatattgattatggcataaacatttcaacacttttggggtgttggagccaaggattttgaggaaggatacatggagaatcgacacccgcgtgct |
22719132 |
T |
|
| Q |
121 |
aacatgtttacatctcttaagggtctcattgtcacaaacctttaccgagaggacctggaccggttgttagtgaatgattgcgtcttttaaccatatgtcg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22719133 |
aacatgtttacatctcttaagggtctcattgtcacaaacctttaccgagaggacttggaccggttgttagtgaatgattgcgtcttttaaccatatgtcg |
22719232 |
T |
|
| Q |
221 |
ctcgctaaaacgcacattcattctagaacatcagcgtctactctg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22719233 |
ctcgctaaaacgcacattcattctagaacatcagcgtctactctg |
22719277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 68 - 143
Target Start/End: Complemental strand, 36659469 - 36659396
Alignment:
| Q |
68 |
ttggagccaaggattttgaggaaggatacatggagaatcgacacccgcgtgctaacatgtttacatctcttaaggg |
143 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||| |||||||||| |||| | ||||||||||| |||||||| |
|
|
| T |
36659469 |
ttggggccaaggattttgaggaagggtacatggaggatcgacacccacgtggt--gatgtttacatcgcttaaggg |
36659396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 74 - 166
Target Start/End: Complemental strand, 32079363 - 32079271
Alignment:
| Q |
74 |
ccaaggattttgaggaaggatacatggagaatcgacacccgcgtgctaacatgtttacatctcttaagggtctcattgtcacaaacctttacc |
166 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||||||| | |||| || ||||||||| | ||||||| || ||| |||||||||| ||||| |
|
|
| T |
32079363 |
ccaaggattttgagtaagggtacatggaggatcgacactcacgtgttaggatgtttacaccgcttaaggatcacatggtcacaaacccttacc |
32079271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University