View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_high_54 (Length: 251)
Name: NF1153_high_54
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_high_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 9 - 97
Target Start/End: Original strand, 3638017 - 3638105
Alignment:
| Q |
9 |
agcaccacagataaaattccaattacttgcttcagctttggaacattgatgactgcaactttagaatgggaaggtatacctgcatatgt |
97 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3638017 |
agcatcactgataaaattccaattacttgcttcagctttggaacattgatgactgcaactttagaatgggaaggtatacctgcatatgt |
3638105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 3646893 - 3646972
Alignment:
| Q |
18 |
gataaaattccaattacttgcttcagctttggaacattgatgactgcaactttagaatgggaaggtatacctgcatatgt |
97 |
Q |
| |
|
|||||| || |||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
3646893 |
gataaagtttcaattacttgtttcagctttggaactttgatgacagctactttagaatgggaaggtatacctgcatatgt |
3646972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University