View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_high_60 (Length: 241)
Name: NF1153_high_60
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_high_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 96 - 190
Target Start/End: Original strand, 3638011 - 3638105
Alignment:
| Q |
96 |
gaatgaagcaccactgataaaattccaattacttgcttcagctttggaacattgatgactgcaactttagaatgggaaggtatacctgcatatgt |
190 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3638011 |
gaatgaagcatcactgataaaattccaattacttgcttcagctttggaacattgatgactgcaactttagaatgggaaggtatacctgcatatgt |
3638105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 190
Target Start/End: Original strand, 3646889 - 3646972
Alignment:
| Q |
107 |
cactgataaaattccaattacttgcttcagctttggaacattgatgactgcaactttagaatgggaaggtatacctgcatatgt |
190 |
Q |
| |
|
|||||||||| || |||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
3646889 |
cactgataaagtttcaattacttgtttcagctttggaactttgatgacagctactttagaatgggaaggtatacctgcatatgt |
3646972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University