View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_low_20 (Length: 382)
Name: NF1153_low_20
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 104 - 302
Target Start/End: Complemental strand, 3881938 - 3881740
Alignment:
| Q |
104 |
gcagaacaaatgaccacaaccttcaagctgatatccatcctcaacctcacacaagcaaattgcgcaactaggtccagtgtcaaatctctcgcttgaagga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3881938 |
gcagaacaaatgaccacaaccttcaagctgatatccatcctcaacctcacacaagcaaattgggcaactaggtccagtgtcaaatctctcgcttgaagga |
3881839 |
T |
|
| Q |
204 |
ttgcttaaacgtgcaatctcaaaagttatttcctccactcttgatttcaactccgagttaccatgaaaaaggattgtcctgttgcgtgtgttaagccta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
3881838 |
ttgcttaaacgtgcaatctcaaaagttatttcctccactcttgatttcaactccgagttaccatgacaaaggattgtccggttgcgtgtgttaagccta |
3881740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 104 - 270
Target Start/End: Original strand, 39317454 - 39317620
Alignment:
| Q |
104 |
gcagaacaaatgaccacaaccttcaagctgatatccatcctcaacctcacacaagcaaattgcgcaactaggtccagtgtcaaatctctcgcttgaagga |
203 |
Q |
| |
|
|||||||||||||||||| |||||||| | ||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||| | || || |
|
|
| T |
39317454 |
gcagaacaaatgaccacagccttcaagtttatatccatcctcaacctcacacaggcaaattgggcaactaggtccagtgtcaagtctctcaactaaatga |
39317553 |
T |
|
| Q |
204 |
ttgcttaaacgtgcaatctcaaaagttatttcctccactcttgatttcaactccgagttaccatgaa |
270 |
Q |
| |
|
| |||| |||| ||||| || | |||||||||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
39317554 |
tggcttgaacgcgcaatttccagagttatttcctccactcttggtttcaactccttgttgccatgaa |
39317620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 104 - 302
Target Start/End: Original strand, 14011989 - 14012187
Alignment:
| Q |
104 |
gcagaacaaatgaccacaaccttcaagctgatatccatcctcaacctcacacaagcaaattgcgcaactaggtccagtgtcaaatctctcgcttgaagga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14011989 |
gcagaacaaatgaccacaaccttcaagctgatatccatcctcaacctcacacaagcaaattgggcaactaggtccagtgtcaaatctctcgcttgaagga |
14012088 |
T |
|
| Q |
204 |
ttgcttaaacgtgcaatctcaaaagttatttcctccactcttgatttcaactccgagttaccatgaaaaaggattgtcctgttgcgtgtgttaagccta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
14012089 |
ttgcttaaacgtgcaatctcaaaagttatttcctccactcttgatttcaactccgagttaccatgacaaaggattgtccggttgcgtgtgttaagccta |
14012187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University