View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_low_51 (Length: 284)
Name: NF1153_low_51
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 7e-86; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 98 - 274
Target Start/End: Complemental strand, 42103486 - 42103310
Alignment:
| Q |
98 |
ttaacattgacaagtcttaaattttcggaacttgaaaaaccgatgaattttcttcaattaatgtatcaattgttaatgggctggctgaatatttaggtta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42103486 |
ttaacattgacaagtcttaaattttcggaacttgaagaaccgatgaattttcttcaattaatgtatcaattgttaatgggctggctgaatatttaggtta |
42103387 |
T |
 |
| Q |
198 |
atttctttgggataggaatgctgcaatgcttgcttctaaactatttaataaattatcagtgtttttggtcacctatg |
274 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42103386 |
atttctttgagataggaatgatgcaatgcttgcttctaaattatttaataaattatcagtgtttttggtcacctatg |
42103310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 42103632 - 42103540
Alignment:
| Q |
1 |
atttgttgtgttgtgtttgtttcatcnnnnnnncttccaggaactacagaaattcaagcacttgttgtttaaatgcgtcaagttttacagatt |
93 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42103632 |
atttgttgtgttgtgtttgtttcatctttttttcttccaggaactacagaaattcaagcacttgttgtttaaatgcatcaagttttacagatt |
42103540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 174 - 228
Target Start/End: Complemental strand, 42112582 - 42112528
Alignment:
| Q |
174 |
tgggctggctgaatatttaggttaatttctttgggataggaatgctgcaatgctt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42112582 |
tgggctggctgaatatttaggttaatttctttgggataggattgctgcaatgctt |
42112528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 105
Target Start/End: Complemental strand, 42112804 - 42112734
Alignment:
| Q |
35 |
ttccaggaactacagaaattcaagcacttgttgtttaaatgcgtcaagttttacagattgatattaacatt |
105 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| ||| || |||||||||||||||||| |
|
|
| T |
42112804 |
ttccaggaactacagaaattcaaggacttgttgttcgaatgcgtgaaggttcgcagattgatattaacatt |
42112734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University