View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_low_57 (Length: 269)
Name: NF1153_low_57
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 40 - 255
Target Start/End: Complemental strand, 35808601 - 35808386
Alignment:
| Q |
40 |
gctgctactcctacttcttctttttccaatgatatgatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgcagtgacttcagtgata |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808601 |
gctgctactcctacttcttctttttccaatgatatgatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgcagtgacttcagtgata |
35808502 |
T |
 |
| Q |
140 |
atttaagtcacagttcttcgtctcaatcgtttactcgaaatgaaactgtcgatgatttcgttcaaattccttatatattttaatgctgttatcaccccct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808501 |
atttaagtcacagttcttcgtctcaatcgtttactcgaaatgaaactgtcgatgatttcgttcaaattccttatatattttaatgctgttatcaccccct |
35808402 |
T |
 |
| Q |
240 |
ttcccttatattgttg |
255 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
35808401 |
ttcccttattttgttg |
35808386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University