View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_low_68 (Length: 251)
Name: NF1153_low_68
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_low_68 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 31858582 - 31858348
Alignment:
| Q |
16 |
atcagaacttggtgatgacacaatacacaaaggcaagaagagaaagaaacaagttgaacgagacttcaatagtgcttccatcggatgagccaccatctgt |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31858582 |
atcagaacttggtgatgacacaaaacacaatggcaagaagtgaaagaaacaagttgaacgagacttcaatagtgcttccattggatgagccaccatctgt |
31858483 |
T |
|
| Q |
116 |
tgatggtatactttttgatcctgctccacctgcaattcaccaaaactacttcaactaaattgcttaagaaaaaactaggtgaactgagtgaatcaataaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31858482 |
tgatggtatactttttgatcctgctccacctgcaattcaccaaaactacttcaactaaattgcttaagaaaaaactaggtgaactgagtgaatcaataaa |
31858383 |
T |
|
| Q |
216 |
atctatatacctatagtatgattattgatgtattaa |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31858382 |
atctatata-ctatagtatgattattgatgtattaa |
31858348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University