View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_low_69 (Length: 251)
Name: NF1153_low_69
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 9441853 - 9442087
Alignment:
| Q |
1 |
attagaccaggcaccctttagtttttgtgcaagactatggccgatcaagacatcctctgccttctcggcttcaatggattcatgcatggctttcatctcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9441853 |
attagaccaggcaccctttagtttttgtgcaagactatggccgatcaagccatcctctgccttctcggcttcaatggattcatgcatggctttcatctcc |
9441952 |
T |
|
| Q |
101 |
tcttcaacttctcccggtcgatagattttcgacagaatttgctttgcttcctcttccttgctctgtgggaaaagaaaaatgagttctactgttattgtac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9441953 |
tcttcaacttctcccggtcgatagattttcgacagaatttgctttgcttcctcttccttgctctgtgggaaaagaaaaatgagttctactgttattgtac |
9442052 |
T |
|
| Q |
201 |
tgatcgttcacagtgtacgcacgaagttaagctca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9442053 |
tgatcgttcacagtgtacgcacgaagttaagctca |
9442087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 9453084 - 9453261
Alignment:
| Q |
1 |
attagaccaggcaccctttagtttttgtgcaagactatggccgatcaagacatcctctgccttctcggcttcaatggattcatgcatggctttcatctcc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9453084 |
attagaccaagcaccctttagtttttgtgcaagactatgaccgatcaagccttcctctgccttctcggcttcaatggattcatgcatggctttcatttcg |
9453183 |
T |
|
| Q |
101 |
tcttcaacttctcccggtcgatagattttcgacagaatttgctttgcttcctcttccttgctctgtgggaaaagaaaa |
178 |
Q |
| |
|
||| ||||||| || || ||||||||||| | |||||| |||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
9453184 |
tctgcaacttcaccggggcgatagatttttgtcagaataatctttgcttcctcctccttgctctgcgagaaaagaaaa |
9453261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University