View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_low_71 (Length: 248)
Name: NF1153_low_71
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 27 - 170
Target Start/End: Complemental strand, 6299292 - 6299149
Alignment:
| Q |
27 |
cttacaattttcttttggttcgatttagtctcttacaaaattaaacaaatgaaatgagtcaggttagattcatttgtccgcatagctaaggccggctccg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6299292 |
cttacaattttcttttggttcgatttagtctcttacaaaaataaacaaatgaaatgagtcaggttagattcatttgtccgcatagctaaggccggctccg |
6299193 |
T |
|
| Q |
127 |
tgcaaattcaacaaggccccttgcacacgtcctcaaacttagag |
170 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6299192 |
tgcaaattcaacaaggccccttgcacatgtcctcaaacttagag |
6299149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 6299115 - 6299071
Alignment:
| Q |
204 |
cttgtacctatagctaaaatctgccactaaataatctttttccta |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6299115 |
cttgtacctacggctaaaatctgccactaaataatctttttccta |
6299071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University