View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1153_low_85 (Length: 203)
Name: NF1153_low_85
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1153_low_85 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 9 - 135
Target Start/End: Complemental strand, 34190404 - 34190278
Alignment:
| Q |
9 |
gatgatgaagagagtggaagaagtgtggtttgagaagggaaatttggtatatgaatggtgcaaaaacatggtattgttgttgttgaaggatgaatacgtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190404 |
gatgatgaagagagtggaagaagtgtggtttgagaagggaaatttggtatatgaatggtgcaaaaacatggtattgttgttgttgaaggatgaatacgtg |
34190305 |
T |
|
| Q |
109 |
aaagtggtgatgattttgttggagatg |
135 |
Q |
| |
|
|||||||||||| ||||||||| |||| |
|
|
| T |
34190304 |
aaagtggtgatggttttgttggtgatg |
34190278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University