View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11540_high_5 (Length: 225)

Name: NF11540_high_5
Description: NF11540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11540_high_5
NF11540_high_5
[»] chr3 (1 HSPs)
chr3 (11-169)||(28722471-28722629)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 11 - 169
Target Start/End: Complemental strand, 28722629 - 28722471
Alignment:
11 gagcagagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccgcggttgcagtcttgcaggaggtgaactacgttttggcttt 110  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
28722629 gagcacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccacggttgcagtcttgcaggaggtgaactacgttttggcttt 28722530  T
111 tccaggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc 169  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28722529 tccaggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc 28722471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University