View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11540_low_6 (Length: 254)
Name: NF11540_low_6
Description: NF11540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11540_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 91 - 219
Target Start/End: Original strand, 19261102 - 19261230
Alignment:
| Q |
91 |
taaaaaataccccaagcttccagcccatcctttttcacaattctgttttgagaaacactctattggtgaataatttattcccatggcaccggacattttc |
190 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
19261102 |
taaaaaataccccaagctgccagcccatcctttttcacaattctgttttgagaaacactctatcgatgaataatttattcccatggcaccggacattttc |
19261201 |
T |
|
| Q |
191 |
aaagcttcttaattgcgagaaccagtccc |
219 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
19261202 |
aaagcttcttaattgcgaaaaccagtccc |
19261230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 19261054 - 19261103
Alignment:
| Q |
12 |
aagcaaaggacaggagaaaaacatgtatctgcaactttcttctgctgcta |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19261054 |
aagcaaaggacaggagaaaaacatgtatctgcaactttcttctgctgcta |
19261103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University