View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11541_low_23 (Length: 269)
Name: NF11541_low_23
Description: NF11541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11541_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 42894142 - 42893905
Alignment:
| Q |
14 |
cagagagcatcacatacatgagacaacgaggacaacctactaacagcatggaggttgcttcagggctgcttgatccattctcagatgaaacacatgaact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42894142 |
cagagagcatcacatacatgagacaacgaggacaacctactaacagcatggaggttgcttcagggctgcttgatccattctcagatgaaacacatgaact |
42894043 |
T |
|
| Q |
114 |
cggcggcgacaccgacgctgatcgtgttggtgatgattccattcttctgttcacccttggtggtgacaaattcagcttcaaatctagctttggcccactt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42894042 |
cggcggcgacaccgacgctgatcgtgttggtgatgattccattcttctgttcacccttggtggtgacaaattcagcttcaaatctagctttggcccactt |
42893943 |
T |
|
| Q |
214 |
ccgtttcttctactcatcttcttcctctgttttcctct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42893942 |
ccgtttcttctactcatcttcttcctctgttttcctct |
42893905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University