View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11541_low_30 (Length: 234)
Name: NF11541_low_30
Description: NF11541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11541_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 29456725 - 29456926
Alignment:
| Q |
14 |
gtaaggggtttttaaacaaat-----ggcttactatggcactttgtatttatgatttgaaaacataatgctagttatttataatttggttaaacatttaa |
108 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456725 |
gtaaggggtttttaaacaaattaataggcttactatggcactttgtatttatgatttgaaaacataatgctagttatttataatttggttaaacatttaa |
29456824 |
T |
|
| Q |
109 |
aagggatttccataggttattacaaacccatcatatatttctcatttgaaagagnnnnnnnnttggcaaggtgaggtgtcagaggtgctttcaagaagca |
208 |
Q |
| |
|
|| |||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456825 |
aa-ggatttccataggttattacgaacccatcatatatttctcatttgaaaaa----aaaaattggcaaggtgaggtgtcagaggtgctttcaagaagca |
29456919 |
T |
|
| Q |
209 |
caggtaa |
215 |
Q |
| |
|
||||||| |
|
|
| T |
29456920 |
caggtaa |
29456926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 50 - 208
Target Start/End: Original strand, 29448816 - 29448968
Alignment:
| Q |
50 |
tttgtatttatgatttgaaaacataatgctagttatttataatttggttaaacatttaaaagggatttccataggttattacaaacccatcatatatttc |
149 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||| ||||||||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29448816 |
tttgtatttatgatttgaaa-cataattctagttacttataatttggctaaacatttaacaggtatttccataggttattacaaacccgtcatatatttc |
29448914 |
T |
|
| Q |
150 |
tcatttgaaagagnnnnnnnnttggcaaggtgaggtgtcagaggtgctttcaagaagca |
208 |
Q |
| |
|
|||||| | | || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29448915 |
tcatttcaga-----acaattttcgcaaggtgaggtgtcagaggtgctttcaagaagca |
29448968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University