View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11541_low_32 (Length: 211)
Name: NF11541_low_32
Description: NF11541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11541_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 42 - 193
Target Start/End: Original strand, 39492442 - 39492593
Alignment:
| Q |
42 |
tatacgacgcgaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39492442 |
tatacgacgcgaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtg |
39492541 |
T |
|
| Q |
142 |
cttcccttccaattgctgttcctattatcaaagaaattgatttgtataagtt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39492542 |
cttcccttccaattgctgttcctattatcaaagaaattgatttgtataagtt |
39492593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 52 - 193
Target Start/End: Original strand, 44370809 - 44370950
Alignment:
| Q |
52 |
gaatgcaaggagcattagagttaccacctggcttcagatttcaccctactgatgatgagcttgtgaatcactacttgtgtagaaagtgtgcttcccttcc |
151 |
Q |
| |
|
|||||||||| | |||||| ||||||||||| ||||||||||||||||||||||| || | |||||||||||||||||| | || |||||| | | |
|
|
| T |
44370809 |
gaatgcaaggtgaattagaattaccacctggtttcagatttcaccctactgatgaagaattggtgaatcactacttgtgtcgcaaatgtgctggtcaatc |
44370908 |
T |
|
| Q |
152 |
aattgctgttcctattatcaaagaaattgatttgtataagtt |
193 |
Q |
| |
|
||| ||||||| || |||||||| |||||||||||||||| |
|
|
| T |
44370909 |
tatttctgttcccgttgtcaaagaagttgatttgtataagtt |
44370950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University