View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11542_low_2 (Length: 241)
Name: NF11542_low_2
Description: NF11542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11542_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 25629075 - 25629300
Alignment:
| Q |
1 |
ttatttcaattgttggaataatcttttgtttgtatttcaagcggatgaaatttcatagtaattatacagtccttttgaaagnnnnnnngctctttaaacc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
25629075 |
ttatctcaattgttggaataatcttttgtttgtatttcaagcggatgaaatttcatagtaattatacagtcattttgaaagaaaaaaagctctttaaacc |
25629174 |
T |
|
| Q |
101 |
aacaatgagaagggaatcaaaacacatatttcaatcatcttgtgccttaagttttcttttagtattgtttcagatacacacttgagatttatgatttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25629175 |
aacaatgagaagggaatcaaaacacatatttcaatcatcttg--ccttaagttttcttttagtattgtttcagatacacacttgagatttatgatttgga |
25629272 |
T |
|
| Q |
201 |
atattagtctttaatatgtaacaattga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25629273 |
atattagtctttaatatgtaacaattga |
25629300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University