View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11543_high_23 (Length: 297)
Name: NF11543_high_23
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11543_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 97 - 283
Target Start/End: Original strand, 10048642 - 10048828
Alignment:
| Q |
97 |
gagggtcaaattctcacgataattcttttttatgaagaattattataacatttggttaataagcaaatatgttggtatatcaataatcgtattagagcta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10048642 |
gagggtcaaattctcacgataattcttttttatgaagaattattataacatttggttaataagcaaatatgttggtatatcaataatcgtattggagcta |
10048741 |
T |
 |
| Q |
197 |
gctaaaaatgtagttattcatgtcattgcatgaattacctcatttgttagtctccgactaaactcaacacgaatttcattaccctct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||| |
|
|
| T |
10048742 |
gctaaaaatgtagttattcatgtcattgcatgaattacctcatttgttagtctgcgactaaactcaacacaaattttattaccctct |
10048828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University